Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249673

Morpholino Name: has2 MO3
Synonyms: Xhas2-MO
mRNA Target: has2

Morpholino Type: uncategorized morpholino
Sequence:
5' ATAAACCGTTCACAGTGCATCTTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' TGCAGATGCACTGTGAACGGTTTAT 3' |||||||||||||||||||||| 3' GGTTCTACGTGACACTTGCCAAATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold220448:961433..961457 22/25 Antisense off-target Xelaev16028593m
Scaffold250769:671777..671801 22/25 Antisense off-target Xelaev16033323m
Scaffold12933:1392761..1392785 21/25 Antisense off-target Xelaev16008255m
tropicalis 7.1 scaffold_2:131969962..131969986 22/25 unknown
scaffold_6:9441620..9441644 22/25 Antisense target has2
Publications
First: XHAPLN3 plays a key role in cardiogenesis by maintaining the hyaluronan matrix around heart anlage., Dev Biol 2008                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556