Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249677

Morpholino Name: hes4 MO1
Synonyms: Hairy2a MO, Hairy2aMO, Xhairy2a MO, hairy2a
mRNA Target: hes4

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGGTATCTGCGGGCATGTTCAGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' ATCTGAACATGCCTGCAGATAGTAT 3' | ||||||||||| ||||||| || 3' TTGACTTGTACGGGCGTCTATGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold154389:3258296..3258320 25/25 unknown
Scaffold169907:2581701..2581725 21/25 unknown
Scaffold175133:838581..838605 21/25 Sense off-target gipc1.L
Scaffold227074:47..71 21/25 unknown
Scaffold66475:1368105..1368129 21/25 Antisense target hes4.L
tropicalis 7.1 scaffold_1:107182983..107183007 21/25 unknown
scaffold_10:6560388..6560412 21/25 Antisense off-target samhd1
scaffold_5:94253981..94254005 21/25 Antisense off-target ugp2
Publications
First: The Notch-target gene hairy2a impedes the involution of notochordal cells by promoting floor plate fates in Xenopus embryos., Development 2005                
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556