Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249678

Morpholino Name: hes4 MO2
Synonyms: Hairy2b MO, Hairy2bMO, Xhairy2b
mRNA Target: hes4

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCATGTTCAGATGTTGTATCCGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCCGGATACAACATCTGAACATGCC 3' ||||||||||||||||||||||||| 3' AGGCCTATGTTGTAGACTTGTACGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold66475:1368117..1368141 25/25 Antisense target hes4.L
Scaffold169907:2581713..2581737 24/25 unknown
Scaffold175133:838569..838593 24/25 Sense off-target gipc1.L
Scaffold227074:35..59 24/25 unknown
Scaffold247724:5403461..5403485 22/25 Antisense off-target Xelaev16033121m
Scaffold2049:583522..583546 21/25 Antisense off-target Xelaev16026366m
Scaffold20641:2214563..2214587 21/25 Antisense off-target Xelaev16026604m
Scaffold25254:4213503..4213527 21/25 Antisense off-target atxn2.L
Publications
First: The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen., Development 2006                    
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556