Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249684

Morpholino Name: hes7.1 MO1
Synonyms: XHR1-MO3
Target mRNA: hes7.1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTAAGATGATGATGACGATGATGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' TCTTCATCATCATCATCATCTTACC 3' || ||||| |||||||||||||||| 3' AGTAGTAGCAGTAGTAGTAGAATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold193742:401957..401981 23/25 Antisense target hes7.1.L
Scaffold120166:25073..25097 23/25 Antisense off-target Xelaev16005157m
Scaffold20641:1844074..1844098 23/25 Antisense off-target Xelaev16026596m
Scaffold267727:1026270..1026294 23/25 Sense off-target mecom.S
Scaffold315413:1181478..1181502 23/25 Sense off-target Xelaev16042258m
Scaffold48253:2049423..2049447 23/25 Sense off-target Xelaev16057566m
Scaffold109621:130789..130813 22/25 Sense off-target Xelaev16002537m
Scaffold1168:1308781..1308805 22/25 Sense off-target Xelaev16004484m
Scaffold1187:2777510..2777534 22/25 Sense off-target Xelaev16004820m
Scaffold12518:658952..658976 22/25 Sense off-target Xelaev16006926m
Scaffold160942:3674357..3674381 22/25 Sense off-target Xelaev16017694m
Scaffold169011:184300..184324 22/25 Sense off-target Xelaev16020054m
Scaffold187321:3420095..3420119 22/25 Sense off-target Xelaev16023366m
Scaffold22011:245430..245454 22/25 Sense off-target Xelaev16028532m
Scaffold220448:1571124..1571148 22/25 Sense off-target Xelaev16028600m
Scaffold236382:3495649..3495673 22/25 Sense off-target Xelaev16031458m
Scaffold26505:1635566..1635590 22/25 Antisense off-target Xelaev16035539m
Scaffold293841:208456..208480 22/25 Sense off-target ptma.L
Scaffold303743:309053..309077 22/25 Sense off-target mfap2.L
Scaffold36364:2295441..2295465 22/25 Sense off-target Xelaev16047330m
Scaffold38656:1037237..1037261 22/25 Sense off-target mtmr10.S
Scaffold39604:460968..460992 22/25 Antisense off-target Xelaev16050327m
Scaffold51452:2202310..2202334 22/25 Sense off-target prlr.S
Scaffold51654:1163092..1163116 22/25 Sense off-target phactr1.S
Scaffold53445:46926..46950 22/25 Sense off-target Xelaev16061324m
Scaffold67962:1768243..1768267 22/25 Sense off-target ptprf.L
Scaffold71264:3230632..3230656 22/25 Sense off-target Xelaev16070004m
Scaffold78978:4627362..4627386 22/25 Sense off-target rangap1.L
Scaffold82102:4191132..4191156 22/25 Sense off-target Xelaev16075165m
Scaffold102974:20119461..20119485 21/25 Sense off-target rtn4.L
Scaffold103899:302402..302426 21/25 Sense off-target Xelaev16001061m
Scaffold11701:549795..549819 21/25 Antisense off-target Xelaev16004612m
Scaffold12462:1156890..1156914 21/25 Sense off-target Xelaev16006676m
Scaffold128184:314693..314717 21/25 Antisense off-target Xelaev16007951m
Scaffold129797:2217164..2217188 21/25 Sense off-target Xelaev16008564m
Scaffold130324:1111414..1111438 21/25 Sense off-target Xelaev16008670m
Scaffold13265:2039481..2039505 21/25 Sense off-target Xelaev16009266m
Scaffold133814:1797277..1797301 21/25 Antisense off-target Xelaev16009874m
Scaffold13787:3009756..3009780 21/25 Sense off-target Xelaev16011647m
Scaffold14557:804874..804898 21/25 Antisense off-target Xelaev16013187m
Scaffold149581:2509852..2509876 21/25 Sense off-target Xelaev16014171m
Scaffold14978:7703094..7703118 21/25 Sense off-target vwa8.L
Scaffold164049:1584132..1584156 21/25 Sense off-target Xelaev16018558m
Scaffold16807:11153171..11153195 21/25 Antisense off-target Xelaev16019664m
Scaffold175714:469740..469764 21/25 Sense off-target Xelaev16021148m
Scaffold176303:115249..115273 21/25 Sense off-target Xelaev16021317m
Scaffold18192:727581..727605 21/25 Sense off-target Xelaev16022406m
Scaffold207705:321043..321067 21/25 Antisense off-target Xelaev16026889m
Scaffold221007:2870749..2870773 21/25 Sense off-target Xelaev16028812m
Scaffold230826:4181330..4181354 21/25 Sense off-target Xelaev16030012m
Scaffold23301:138187..138211 21/25 Sense off-target Xelaev16030576m
Scaffold24606:42292..42316 21/25 Sense off-target Xelaev16032949m
Scaffold25194:1018313..1018337 21/25 Sense off-target Xelaev16033585m
Scaffold268161:25552..25576 21/25 Sense off-target Xelaev16036158m
Scaffold27038:1276644..1276668 21/25 Sense off-target cdc25b.L
Scaffold272406:3392599..3392623 21/25 Antisense off-target Xelaev16037453m
Scaffold287959:2798036..2798060 21/25 Sense off-target cbl.L
Scaffold294734:750964..750988 21/25 Antisense off-target Xelaev16039507m
Scaffold30581:238813..238837 21/25 Sense off-target Xelaev16041313m
Scaffold30711:611309..611333 21/25 Sense off-target mtf1.L
Scaffold32212:7037584..7037608 21/25 Antisense off-target Xelaev16042895m
Scaffold33104:2256195..2256219 21/25 Sense off-target srpk3.S
Scaffold34423:2813004..2813028 21/25 Sense off-target Xelaev16045023m
Scaffold34503:1513795..1513819 21/25 Antisense off-target gdf6.S
Scaffold3467:3888090..3888114 21/25 Sense off-target fgfr3.L
Scaffold347078:786182..786206 21/25 Sense off-target casq2.S
Scaffold356123:772439..772463 21/25 Antisense off-target Xelaev16046662m
Scaffold356308:127442..127466 21/25 Sense off-target was.L
Scaffold36401:1900450..1900474 21/25 Antisense off-target Xelaev16047469m
Scaffold36991:2698722..2698746 21/25 Antisense off-target efnb1.L
Scaffold387025:8844..8868 21/25 Sense off-target gon4l.L
Scaffold39723:1139905..1139929 21/25 Antisense off-target Xelaev16050543m
Scaffold402161:259273..259297 21/25 Sense off-target Xelaev16051437m
Scaffold40886:138151..138175 21/25 Sense off-target Xelaev16051855m
Scaffold41091:1181929..1181953 21/25 Sense off-target casq1.S
Scaffold4321:11499885..11499909 21/25 Sense off-target Xelaev16053157m
Scaffold43242:11315538..11315562 21/25 Sense off-target Xelaev16053604m
Scaffold43791:2916337..2916361 21/25 Sense off-target Xelaev16054152m
Scaffold44247:32222..32246 21/25 Sense off-target Xelaev16054472m
Scaffold44494:3219390..3219414 21/25 Sense off-target Xelaev16054620m
Scaffold45774:2085046..2085070 21/25 Sense off-target ncl.S
Scaffold45965:2524263..2524287 21/25 Antisense off-target Xelaev16055595m
Scaffold45985:272707..272731 21/25 Antisense off-target Xelaev16055616m
Scaffold47026:117130..117154 21/25 Antisense off-target Xelaev16056393m
Scaffold47457:763893..763917 21/25 Sense off-target Xelaev16056755m
Scaffold50079:4857548..4857572 21/25 Sense off-target Xelaev16058263m
Scaffold50694:6274431..6274455 21/25 Antisense off-target bloc1s3.S
Scaffold52441:12654056..12654080 21/25 Sense off-target dhx29.L
Scaffold5370:838321..838345 21/25 Sense off-target Xelaev16061460m
Scaffold5375:926417..926441 21/25 Antisense off-target Xelaev16061564m
Scaffold54194:5659..5683 21/25 Sense off-target cdhr5.S
Scaffold54274:1245310..1245334 21/25 Sense off-target Xelaev16061765m
Scaffold56125:1684419..1684443 21/25 Sense off-target paqr3.S
Scaffold58049:5448838..5448862 21/25 Sense off-target anp32a.L
Scaffold58517:4302463..4302487 21/25 Sense off-target Xelaev16063979m
Scaffold58784:146383..146407 21/25 Sense off-target Xelaev16064014m
Scaffold59883:3639742..3639766 21/25 Sense off-target Xelaev16065346m
Scaffold60945:294284..294308 21/25 Antisense off-target Xelaev16065811m
Scaffold61078:578367..578391 21/25 Sense off-target Xelaev16065838m
Scaffold68269:321755..321779 21/25 Sense off-target Xelaev16068456m
Scaffold69443:5176335..5176359 21/25 Sense off-target Xelaev16068888m
Scaffold70222:123465..123489 21/25 Antisense off-target stat6.L
Scaffold7331:1851263..1851287 21/25 Sense off-target Xelaev16070669m
Scaffold74352:427210..427234 21/25 Antisense off-target Xelaev16070921m
Scaffold74750:44639..44663 21/25 Sense off-target Xelaev16071359m
Scaffold75417:2346184..2346208 21/25 Antisense off-target Xelaev16071833m
Scaffold7555:875912..875936 21/25 Sense off-target Xelaev16072373m
Scaffold79772:2439364..2439388 21/25 Sense off-target bicc1.L
Scaffold8129:7591838..7591862 21/25 Antisense off-target nabp2.S
Scaffold83691:1435264..1435288 21/25 Sense off-target Xelaev16075680m
Scaffold85380:979..1003 21/25 Sense off-target Xelaev16076021m
Scaffold86880:35479..35503 21/25 Sense off-target Xelaev16076713m
Scaffold8828:633844..633868 21/25 Sense off-target Xelaev16077165m
Scaffold89040:2017361..2017385 21/25 Sense off-target Xelaev16077660m
Scaffold9266:11838779..11838803 21/25 Sense off-target Xelaev16078925m
Scaffold93635:178523..178547 21/25 Sense off-target Xelaev16079090m
Scaffold93786:1723669..1723693 21/25 Antisense off-target Xelaev16079186m
Scaffold939:3926972..3926996 21/25 Sense off-target srl.L
Scaffold97342:487793..487817 21/25 Sense off-target npm1.L
Scaffold98463:818136..818160 21/25 Sense off-target Xelaev16080573m
Scaffold9994:2811624..2811648 21/25 Sense off-target cpped1.L
Scaffold2409:534392..534416 23/25 unknown
Scaffold63696:368303..368327 23/25 unknown
Scaffold13523:5055444..5055468 22/25 unknown
Scaffold135348:1623447..1623471 22/25 unknown
Scaffold14692:1840901..1840925 22/25 unknown
Scaffold159287:866146..866170 22/25 unknown
Scaffold162275:352..376 22/25 unknown
Scaffold162385:85336..85360 22/25 unknown
Scaffold181837:709913..709937 22/25 unknown
Scaffold220408:73..97 22/25 unknown
Scaffold247724:201036..201060 22/25 unknown
Scaffold286106:43..67 22/25 unknown
Scaffold325719:5..29 22/25 unknown
Scaffold373399:2046538..2046562 22/25 unknown
Scaffold404817:302203..302227 22/25 unknown
Scaffold48687:497551..497575 22/25 unknown
Scaffold5269:1004388..1004412 22/25 unknown
Scaffold6546:723460..723484 22/25 unknown
Scaffold82610:768139..768163 22/25 unknown
Scaffold102068:512163..512187 21/25 unknown
Scaffold106789:2291253..2291277 21/25 unknown
Scaffold108224:1095335..1095359 21/25 unknown
Scaffold109418:1292645..1292669 21/25 unknown
Scaffold112535:197..221 21/25 unknown
Scaffold11605:11311..11335 21/25 unknown
Scaffold12020:13675462..13675486 21/25 unknown
Scaffold12423:1188368..1188392 21/25 unknown
Scaffold124774:1065414..1065438 21/25 unknown
Scaffold13204:1643111..1643135 21/25 unknown
Scaffold1391:2036794..2036818 21/25 unknown
Scaffold142445:2041422..2041446 21/25 unknown
Scaffold143831:2296553..2296577 21/25 unknown
Scaffold144508:133807..133831 21/25 unknown
Scaffold149890:3407436..3407460 21/25 unknown
Scaffold15893:3951696..3951720 21/25 unknown
Scaffold16001:4693231..4693255 21/25 unknown
Scaffold160841:2794009..2794033 21/25 unknown
Scaffold163806:5158706..5158730 21/25 unknown
Scaffold16424:75662..75686 21/25 unknown
Scaffold167265:2111884..2111908 21/25 unknown
Scaffold16863:6911142..6911166 21/25 unknown
Scaffold169907:195483..195507 21/25 unknown
Scaffold175547:3194921..3194945 21/25 unknown
Scaffold18184:3346963..3346987 21/25 unknown
Scaffold1915:1103242..1103266 21/25 unknown
Scaffold193187:102720..102744 21/25 unknown
Scaffold195950:1488417..1488441 21/25 unknown
Scaffold200825:2937803..2937827 21/25 unknown
Scaffold202158:2050259..2050283 21/25 unknown
Scaffold203187:1001016..1001040 21/25 unknown
Scaffold203280:897619..897643 21/25 unknown
Scaffold206536:280..304 21/25 unknown
Scaffold21603:7797419..7797443 21/25 unknown
Scaffold218195:625364..625388 21/25 unknown
Scaffold22127:4450610..4450634 21/25 unknown
Scaffold222217:49584..49608 21/25 unknown
Scaffold23403:11065376..11065400 21/25 unknown
Scaffold235536:25..49 21/25 unknown
Scaffold237598:426106..426130 21/25 unknown
Scaffold239343:607..631 21/25 unknown
Scaffold24235:1558920..1558944 21/25 unknown
Scaffold246008:277..301 21/25 unknown
Scaffold25254:563615..563639 21/25 unknown
Scaffold255210:311..335 21/25 unknown
Scaffold255257:998397..998421 21/25 unknown
Scaffold256647:1840977..1841001 21/25 unknown
Scaffold258556:431..455 21/25 unknown
Scaffold26364:1246194..1246218 21/25 unknown
Scaffold266756:433774..433798 21/25 unknown
Scaffold27036:4816137..4816161 21/25 unknown
Scaffold27115:378118..378142 21/25 unknown
Scaffold272282:284..308 21/25 unknown
Scaffold273432:2843..2867 21/25 unknown
Scaffold275342:2509984..2510008 21/25 unknown
Scaffold2874:92..116 21/25 unknown
Scaffold289035:10140..10164 21/25 unknown
Scaffold29621:1838409..1838433 21/25 unknown
Scaffold29869:530049..530073 21/25 unknown
Scaffold29940:1676010..1676034 21/25 unknown
Scaffold30080:1283760..1283784 21/25 unknown
Scaffold302461:159..183 21/25 unknown
Scaffold30470:2052148..2052172 21/25 unknown
Scaffold308427:856..880 21/25 unknown
Scaffold30987:1509533..1509557 21/25 unknown
Scaffold31469:1182587..1182611 21/25 unknown
Scaffold316228:154..178 21/25 unknown
Scaffold316819:32..56 21/25 unknown
Scaffold329983:154..178 21/25 unknown
Scaffold33269:163796..163820 21/25 unknown
Scaffold35524:3476773..3476797 21/25 unknown
Scaffold357936:198..222 21/25 unknown
Scaffold367645:101..125 21/25 unknown
Scaffold374157:151..175 21/25 unknown
Scaffold376268:78..102 21/25 unknown
Scaffold379358:26..50 21/25 unknown
Scaffold387661:602..626 21/25 unknown
Scaffold3881:892671..892695 21/25 unknown
Scaffold393432:75..99 21/25 unknown
Scaffold394073:3481..3505 21/25 unknown
Scaffold39431:499881..499905 21/25 unknown
Scaffold42960:4939093..4939117 21/25 unknown
Scaffold43061:1723774..1723798 21/25 unknown
Scaffold44546:772709..772733 21/25 unknown
Scaffold44863:269955..269979 21/25 unknown
Scaffold45400:233487..233511 21/25 unknown
Scaffold46492:1238717..1238741 21/25 unknown
Scaffold47533:4527202..4527226 21/25 unknown
Scaffold47606:2828706..2828730 21/25 unknown
Scaffold47683:3983417..3983441 21/25 unknown
Scaffold49409:13826..13850 21/25 unknown
Scaffold51988:2151463..2151487 21/25 unknown
Scaffold52170:115987..116011 21/25 unknown
Scaffold52487:287067..287091 21/25 unknown
Scaffold52573:12278740..12278764 21/25 unknown
Scaffold52702:8860143..8860167 21/25 unknown
Scaffold53263:248515..248539 21/25 unknown
Scaffold54899:274089..274113 21/25 unknown
Scaffold56777:1925544..1925568 21/25 unknown
Scaffold57180:3469065..3469089 21/25 unknown
Scaffold5732:3687074..3687098 21/25 unknown
Scaffold57559:1738221..1738245 21/25 unknown
Scaffold5925:10766544..10766568 21/25 unknown
Scaffold60518:1134707..1134731 21/25 unknown
Scaffold61741:2681052..2681076 21/25 unknown
Scaffold62432:34361..34385 21/25 unknown
Scaffold65414:1338279..1338303 21/25 unknown
Scaffold6590:2015763..2015787 21/25 unknown
Scaffold67738:768779..768803 21/25 unknown
Scaffold678:191703..191727 21/25 unknown
Scaffold68908:309516..309540 21/25 unknown
Scaffold6891:104191..104215 21/25 unknown
Scaffold7045:2973005..2973029 21/25 unknown
Scaffold70754:44318..44342 21/25 unknown
Scaffold7103:1602287..1602311 21/25 unknown
Scaffold74339:837642..837666 21/25 unknown
Scaffold7546:1399915..1399939 21/25 unknown
Scaffold78860:3984810..3984834 21/25 unknown
Scaffold8276:712344..712368 21/25 unknown
Scaffold83323:154242..154266 21/25 unknown
Scaffold84303:1415868..1415892 21/25 unknown
Scaffold86352:984735..984759 21/25 unknown
Scaffold86871:10582..10606 21/25 unknown
Scaffold86967:806506..806530 21/25 unknown
Scaffold89111:124..148 21/25 unknown
Scaffold90041:4498165..4498189 21/25 unknown
Scaffold91950:297924..297948 21/25 unknown
Scaffold93052:143868..143892 21/25 unknown
Scaffold94859:669749..669773 21/25 unknown
Scaffold96659:6885544..6885568 21/25 unknown
Scaffold99286:3821298..3821322 21/25 unknown
tropicalis 7.1 scaffold_3:7699064..7699088 24/25 Sense off-target pebp4
scaffold_2:41532049..41532073 23/25 Sense off-target nlk
scaffold_4:116715127..116715151 23/25 Sense off-target dcaf1
scaffold_1:172593736..172593760 22/25 Antisense off-target naf1
scaffold_1:181334404..181334428 22/25 Antisense off-target mtus1
scaffold_2:49407070..49407094 22/25 Sense off-target dmd.1
scaffold_4:85517594..85517618 22/25 Sense off-target ecm2.1
scaffold_5:100845010..100845034 22/25 Sense off-target plcb1
scaffold_5:42849654..42849678 22/25 Sense off-target mdn1
scaffold_6:128788241..128788265 22/25 Sense off-target dnajb6
scaffold_626:30636..30660 22/25 Sense off-target rbm28
scaffold_7:541622..541646 22/25 Sense off-target kiaa2022
scaffold_8:95582789..95582813 22/25 Antisense off-target crip2
scaffold_9:60263808..60263832 22/25 Sense off-target kiaa0556
scaffold_9:80417264..80417288 22/25 Sense off-target grid2ip
scaffold_1:101636597..101636621 21/25 Sense off-target tnpo1
scaffold_1:128333172..128333196 21/25 Sense off-target sugp2
scaffold_1:175222457..175222481 21/25 Sense off-target hmgb2
scaffold_1:181575536..181575560 21/25 Antisense off-target vps37a
scaffold_1:181575539..181575563 21/25 Antisense off-target vps37a
scaffold_1:200315492..200315516 21/25 Sense off-target uvssa
scaffold_1:30257803..30257827 21/25 Sense off-target riok2
scaffold_1:48950465..48950489 21/25 Sense off-target tmem132c
scaffold_1:48950498..48950522 21/25 Sense off-target tmem132c
scaffold_1:63615715..63615739 21/25 Sense off-target pes1
scaffold_1:86318133..86318157 21/25 Sense off-target rnf31
scaffold_1:87778040..87778064 21/25 Antisense off-target sema4d
scaffold_1:96848792..96848816 21/25 Sense off-target smarca2
scaffold_10:12995920..12995944 21/25 Antisense off-target rnf114
scaffold_10:18154658..18154682 21/25 Sense off-target ubtf
scaffold_10:26887968..26887992 21/25 Antisense off-target grn
scaffold_10:26887971..26887995 21/25 Antisense off-target grn
scaffold_10:6312784..6312808 21/25 Sense off-target fer1l4
scaffold_181:158948..158972 21/25 Sense off-target fam50a
scaffold_2:115222878..115222902 21/25 Antisense off-target robo2
scaffold_2:127405723..127405747 21/25 Sense off-target cryzl1
scaffold_2:130178788..130178812 21/25 Sense off-target grik1
scaffold_2:14573742..14573766 21/25 Antisense off-target cltc
scaffold_2:77180708..77180732 21/25 Sense off-target nckap5l
scaffold_230:125392..125416 21/25 Sense off-target pcolce
scaffold_230:125395..125419 21/25 Sense off-target pcolce
scaffold_26:244791..244815 21/25 Sense off-target znf653
scaffold_26:247018..247042 21/25 Sense off-target znf653
scaffold_28:84908..84932 21/25 Antisense off-target efnb1
scaffold_3:17798074..17798098 21/25 Sense off-target map2k5
scaffold_3:1989583..1989607 21/25 Sense off-target nup205
scaffold_3:2894741..2894765 21/25 Sense off-target washc1
scaffold_3:2894741..2894765 21/25 Antisense off-target ddx11
scaffold_3:32897811..32897835 21/25 Sense off-target slc24a1
scaffold_3:32897820..32897844 21/25 Sense off-target slc24a1
scaffold_3:49484674..49484698 21/25 Antisense off-target neurog1
scaffold_3:49484677..49484701 21/25 Antisense off-target neurog1
scaffold_3:54902037..54902061 21/25 Sense off-target npm1
scaffold_3:6809616..6809640 21/25 Sense off-target fgfr1
scaffold_3:7699079..7699103 21/25 Sense off-target pebp4
scaffold_3:9684861..9684885 21/25 Sense off-target bnip3l
scaffold_4:11357283..11357307 21/25 Sense off-target zdhhc5
scaffold_4:1251408..1251432 21/25 Sense off-target prmt3
scaffold_4:43227224..43227248 21/25 Antisense off-target piezo1
scaffold_4:582882..582906 21/25 Sense off-target pik3c2a
scaffold_4:6583340..6583364 21/25 Antisense off-target cd44
scaffold_4:85034191..85034215 21/25 Sense off-target eif3d
scaffold_4:87822019..87822043 21/25 Antisense off-target vtga2
scaffold_5:101814370..101814394 21/25 Antisense off-target capn8
scaffold_5:110753630..110753654 21/25 Antisense off-target kcng3
scaffold_5:118379085..118379109 21/25 Sense off-target stum
scaffold_5:121864941..121864965 21/25 Sense off-target mocs1
scaffold_5:15955212..15955236 21/25 Sense off-target tnik
scaffold_5:3793434..3793458 21/25 Antisense off-target hrg
scaffold_5:61590417..61590441 21/25 Sense off-target moxd1
scaffold_5:98857449..98857473 21/25 Sense off-target esf1
scaffold_53:95385..95409 21/25 Sense off-target khsrp
scaffold_5b:663088..663112 21/25 Antisense off-target ptk2b
scaffold_6:134813502..134813526 21/25 Antisense off-target pth1r
scaffold_6:21904511..21904535 21/25 Sense off-target fam92a
scaffold_6:28039814..28039838 21/25 Antisense off-target crispld1
scaffold_6:40805513..40805537 21/25 Sense off-target npca1
scaffold_6:56245435..56245459 21/25 Sense off-target phactr1
scaffold_6:56245447..56245471 21/25 Sense off-target phactr1
scaffold_6:69564115..69564139 21/25 Antisense off-target trio
scaffold_6:92037292..92037316 21/25 Sense off-target trak1
scaffold_6:98089437..98089461 21/25 Sense off-target top2b
scaffold_7:1431012..1431036 21/25 Sense off-target tcf7l2
scaffold_7:18142257..18142281 21/25 Sense off-target hmx3
scaffold_7:5735893..5735917 21/25 Sense off-target zbtb33
scaffold_7:61637412..61637436 21/25 Sense off-target casz1
scaffold_7:70148431..70148455 21/25 Sense off-target ift46
scaffold_7:70148476..70148500 21/25 Sense off-target ift46
scaffold_7:7076050..7076074 21/25 Sense off-target chd4
scaffold_7:82261748..82261772 21/25 Sense off-target samd11
scaffold_7:86570953..86570977 21/25 Sense off-target prdm10
scaffold_8:22370647..22370671 21/25 Sense off-target vsig4
scaffold_8:65849391..65849415 21/25 Antisense off-target meis3
scaffold_8:65951111..65951135 21/25 Antisense off-target spred3
scaffold_8:76711484..76711508 21/25 Sense off-target mark3
scaffold_8:99619115..99619139 21/25 Sense off-target tll2
scaffold_840:10440..10464 21/25 Antisense off-target aqp10
scaffold_8c:1813387..1813411 21/25 Sense off-target casq1
scaffold_8c:1813432..1813456 21/25 Sense off-target casq1
scaffold_9:11897650..11897674 21/25 Antisense off-target acvr1c
scaffold_9:12589625..12589649 21/25 Sense off-target baz2b
scaffold_9:16594182..16594206 21/25 Sense off-target oxsr1
scaffold_9:17036704..17036728 21/25 Antisense off-target lrp2
scaffold_9:34572404..34572428 21/25 Sense off-target ankmy1
scaffold_9:34572404..34572428 21/25 Antisense off-target gpc1
scaffold_9:40406542..40406566 21/25 Sense off-target rnf216
scaffold_3:5547400..5547424 23/25 unknown
scaffold_3:5547429..5547453 23/25 unknown
scaffold_6:57407093..57407117 23/25 unknown
scaffold_8:73422067..73422091 23/25 unknown
scaffold_1:120354196..120354220 22/25 unknown
scaffold_1:212900560..212900584 22/25 unknown
scaffold_1:28660242..28660266 22/25 unknown
scaffold_1:28673589..28673613 22/25 unknown
scaffold_100:123923..123947 22/25 unknown
scaffold_2:146483433..146483457 22/25 unknown
scaffold_24:568885..568909 22/25 unknown
scaffold_24:569030..569054 22/25 unknown
scaffold_24:569335..569359 22/25 unknown
scaffold_2698:4384..4408 22/25 unknown
scaffold_3:5491210..5491234 22/25 unknown
scaffold_3:5491326..5491367 22/25 Sense unknown
scaffold_3:5491343..5491367 22/25 unknown
scaffold_3:5498669..5498693 22/25 unknown
scaffold_3:5498689..5498713 22/25 unknown
scaffold_3:5498775..5498799 22/25 unknown
scaffold_3:5498795..5498819 22/25 unknown
scaffold_3:5499033..5499057 22/25 unknown
scaffold_3:5499116..5499140 22/25 unknown
scaffold_3:5499311..5499335 22/25 unknown
scaffold_3:5516935..5516959 22/25 unknown
scaffold_3:5517178..5517202 22/25 unknown
scaffold_3:5517445..5517469 22/25 unknown
scaffold_3:55290672..55290696 22/25 unknown
scaffold_3:5547578..5547602 22/25 unknown
scaffold_3b:212675..212699 22/25 unknown
scaffold_4:138996893..138996917 22/25 unknown
scaffold_4:75234832..75234856 22/25 unknown
scaffold_40:880424..880448 22/25 unknown
scaffold_461:34011..34035 22/25 unknown
scaffold_5:25003488..25003512 22/25 unknown
scaffold_5:38485955..38485979 22/25 unknown
scaffold_5:39621540..39621564 22/25 unknown
scaffold_5:63128237..63128261 22/25 unknown
scaffold_5355:2644..2668 22/25 unknown
scaffold_5b:7451008..7451032 22/25 unknown
scaffold_6:102077862..102077886 22/25 unknown
scaffold_6:102087981..102088005 22/25 unknown
scaffold_6:102088138..102088162 22/25 unknown
scaffold_6:102088161..102088185 22/25 unknown
scaffold_6:102088198..102088222 22/25 unknown
scaffold_6:102088516..102088540 22/25 unknown
scaffold_6:102090502..102090526 22/25 unknown
scaffold_6:102090545..102090569 22/25 unknown
scaffold_6:104296407..104296431 22/25 unknown
scaffold_6:1187657..1187681 22/25 unknown
scaffold_6:57407056..57407080 22/25 unknown
scaffold_6:57407363..57407387 22/25 unknown
scaffold_6:57407389..57407413 22/25 unknown
scaffold_6:76072199..76072223 22/25 unknown
scaffold_6865:2320..2344 22/25 unknown
scaffold_7:113651039..113651063 22/25 unknown
scaffold_7:122711474..122711498 22/25 unknown
scaffold_7:35661686..35661710 22/25 unknown
scaffold_7:35661732..35661756 22/25 unknown
scaffold_7:35661936..35661960 22/25 unknown
scaffold_7:35661971..35661995 22/25 unknown
scaffold_7:35662073..35662097 22/25 unknown
scaffold_7:35662224..35662248 22/25 unknown
scaffold_8:14919970..14919994 22/25 unknown
scaffold_8:58073139..58073163 22/25 unknown
scaffold_8:76309347..76309371 22/25 unknown
scaffold_85:113413..113437 22/25 unknown
scaffold_9:1352182..1353021 22/25 Sense unknown
scaffold_9:1352458..1352482 22/25 unknown
scaffold_9:15737674..15737698 22/25 unknown
scaffold_9:17350081..17350105 22/25 unknown
scaffold_9:17350134..17350158 22/25 unknown
scaffold_9:17350179..17350203 22/25 unknown
scaffold_9:2805392..2805416 22/25 unknown
scaffold_9:33245031..33245055 22/25 unknown
scaffold_9:75055085..75055109 22/25 unknown
scaffold_9:91687652..91687676 22/25 unknown
scaffold_1:120354199..120354223 21/25 unknown
scaffold_1:13030168..13030192 21/25 unknown
scaffold_1:145303649..145303673 21/25 unknown
scaffold_1:188086360..188086384 21/25 unknown
scaffold_1:206436355..206436379 21/25 unknown
scaffold_1:208611539..208611563 21/25 unknown
scaffold_1:208705898..208705922 21/25 unknown
scaffold_1:208705958..208705982 21/25 unknown
scaffold_1:209915834..209915858 21/25 unknown
scaffold_1:23383011..23383035 21/25 unknown
scaffold_1:48040362..48040386 21/25 unknown
scaffold_1:894716..894740 21/25 unknown
scaffold_10:35654116..35654140 21/25 unknown
scaffold_10:36892943..36892967 21/25 unknown
scaffold_1070:12046..12070 21/25 unknown
scaffold_1070:9998..10022 21/25 unknown
scaffold_116:15117..15141 21/25 unknown
scaffold_145:15763..15787 21/25 unknown
scaffold_145:15766..15790 21/25 unknown
scaffold_1470:1421..1445 21/25 unknown
scaffold_159:125176..125200 21/25 unknown
scaffold_17:735290..735314 21/25 unknown
scaffold_189:111846..111870 21/25 unknown
scaffold_2:110956053..110956077 21/25 unknown
scaffold_2:110956065..110956089 21/25 unknown
scaffold_2:112767812..112767836 21/25 unknown
scaffold_2:141980843..141980867 21/25 unknown
scaffold_2:141986005..141986029 21/25 unknown
scaffold_2:144549250..144549274 21/25 unknown
scaffold_2:144812639..144812663 21/25 unknown
scaffold_2:27302688..27302712 21/25 unknown
scaffold_2:29072514..29072538 21/25 unknown
scaffold_2:63992758..63992782 21/25 unknown
scaffold_2:63992761..63992785 21/25 unknown
scaffold_2:64920417..64920441 21/25 unknown
scaffold_2:78326629..78326653 21/25 unknown
scaffold_2:78326779..78326803 21/25 unknown
scaffold_2068:6895..6919 21/25 unknown
scaffold_2068:6898..6922 21/25 unknown
scaffold_2079:5462..5486 21/25 unknown
scaffold_2079:5465..5489 21/25 unknown
scaffold_2147:473..497 21/25 unknown
scaffold_2147:495..519 21/25 unknown
scaffold_2160:8485..8509 21/25 unknown
scaffold_2300:3546..3570 21/25 unknown
scaffold_2300:3549..3573 21/25 unknown
scaffold_257:40421..40445 21/25 unknown
scaffold_265:96348..96372 21/25 unknown
scaffold_2659:3454..3478 21/25 unknown
scaffold_2659:3457..3481 21/25 unknown
scaffold_2720:6416..6440 21/25 unknown
scaffold_2720:6419..6443 21/25 unknown
scaffold_3:101903828..101903852 21/25 unknown
scaffold_3:108416098..108416122 21/25 unknown
scaffold_3:18617362..18617386 21/25 unknown
scaffold_3:35103551..35103575 21/25 unknown
scaffold_3:3612661..3612685 21/25 unknown
scaffold_3:39159857..39159881 21/25 unknown
scaffold_3:39191004..39191028 21/25 unknown
scaffold_3:5498643..5498667 21/25 unknown
scaffold_3:5498709..5498733 21/25 unknown
scaffold_3:5498749..5498773 21/25 unknown
scaffold_3:5498815..5498839 21/25 unknown
scaffold_3:5499036..5499060 21/25 unknown
scaffold_3:5499192..5499216 21/25 unknown
scaffold_3:5499232..5499256 21/25 unknown
scaffold_3:5499314..5499338 21/25 unknown
scaffold_3:5516901..5516925 21/25 unknown
scaffold_3:5516969..5516993 21/25 unknown
scaffold_3:5516972..5516996 21/25 unknown
scaffold_3:5517045..5517069 21/25 unknown
scaffold_3:5517116..5517140 21/25 unknown
scaffold_3:5517181..5517205 21/25 unknown
scaffold_3:5517374..5517398 21/25 unknown
scaffold_3:5517448..5517472 21/25 unknown
scaffold_3:5547154..5547178 21/25 unknown
scaffold_3:5547174..5547198 21/25 unknown
scaffold_3:5547352..5547421 21/25 Sense unknown
scaffold_3:5547380..5547404 21/25 unknown
scaffold_3:5547441..5547465 21/25 unknown
scaffold_3:69454755..69454779 21/25 unknown
scaffold_3:77117277..77117301 21/25 unknown
scaffold_3:81900462..81900486 21/25 unknown
scaffold_31:637252..637276 21/25 unknown
scaffold_3137:3554..3578 21/25 unknown
scaffold_337:33977..34001 21/25 unknown
scaffold_386:87489..87513 21/25 unknown
scaffold_3b:1900237..1900323 21/25 Sense unknown
scaffold_3b:3905446..3905470 21/25 unknown
scaffold_4:1032646..1032670 21/25 unknown
scaffold_4:121630722..121630746 21/25 unknown
scaffold_4:129545515..129545539 21/25 unknown
scaffold_4:138119502..138119526 21/25 unknown
scaffold_4:139883851..139883875 21/25 unknown
scaffold_4:2171654..2171678 21/25 unknown
scaffold_4:29046265..29046289 21/25 unknown
scaffold_4:58492211..58492235 21/25 unknown
scaffold_4:77429613..77429637 21/25 unknown
scaffold_4:98737946..98737970 21/25 unknown
scaffold_42:10300..10324 21/25 unknown
scaffold_42:10536..10610 21/25 Sense unknown
scaffold_4684:2695..2719 21/25 unknown
scaffold_5:100058635..100058659 21/25 unknown
scaffold_5:100058638..100058662 21/25 unknown
scaffold_5:114993402..114993426 21/25 unknown
scaffold_5:12922453..12922477 21/25 unknown
scaffold_5:22199815..22199839 21/25 unknown
scaffold_5:25865812..25865836 21/25 unknown
scaffold_5:33269214..33269238 21/25 unknown
scaffold_5:38485862..38485886 21/25 unknown
scaffold_5:62420336..62420360 21/25 unknown
scaffold_5:95932402..95932426 21/25 unknown
scaffold_5082:23..47 21/25 unknown
scaffold_5082:2496..2520 21/25 unknown
scaffold_5082:3258..3282 21/25 unknown
scaffold_5082:3261..3285 21/25 unknown
scaffold_5082:3283..3307 21/25 unknown
scaffold_5082:3286..3310 21/25 unknown
scaffold_5082:3311..3335 21/25 unknown
scaffold_5082:3314..3338 21/25 unknown
scaffold_5082:3339..3363 21/25 unknown
scaffold_5082:3342..3366 21/25 unknown
scaffold_5082:3364..3388 21/25 unknown
scaffold_5271:3594..3618 21/25 unknown
scaffold_5271:3597..3621 21/25 unknown
scaffold_5607:2724..2748 21/25 unknown
scaffold_5607:2727..2751 21/25 unknown
scaffold_5677:1156..1180 21/25 unknown
scaffold_6:102077523..102077547 21/25 unknown
scaffold_6:102077571..102077595 21/25 unknown
scaffold_6:102077678..102077702 21/25 unknown
scaffold_6:102077723..102077747 21/25 unknown
scaffold_6:102077740..102077764 21/25 unknown
scaffold_6:102077777..102077801 21/25 unknown
scaffold_6:102077845..102077869 21/25 unknown
scaffold_6:102087984..102088008 21/25 unknown
scaffold_6:102088201..102088225 21/25 unknown
scaffold_6:102088327..102088351 21/25 unknown
scaffold_6:102088398..102088422 21/25 unknown
scaffold_6:102090548..102090572 21/25 unknown
scaffold_6:11439561..11439585 21/25 unknown
scaffold_6:123201659..123201683 21/25 unknown
scaffold_6:124914363..124914387 21/25 unknown
scaffold_6:126204027..126204051 21/25 unknown
scaffold_6:131378080..131378104 21/25 unknown
scaffold_6:27728597..27728621 21/25 unknown
scaffold_6:31656089..31656113 21/25 unknown
scaffold_6:35112231..35112255 21/25 unknown
scaffold_6:45990323..45990347 21/25 unknown
scaffold_6:53026067..53026091 21/25 unknown
scaffold_6:57407059..57407083 21/25 unknown
scaffold_6:57407207..57407231 21/25 unknown
scaffold_6:57407442..57407466 21/25 unknown
scaffold_6:57407496..57407520 21/25 unknown
scaffold_6:57407583..57407607 21/25 unknown
scaffold_6:57407617..57407641 21/25 unknown
scaffold_6:57407736..57407760 21/25 unknown
scaffold_6:57407739..57407763 21/25 unknown
scaffold_6:73033298..73033322 21/25 unknown
scaffold_6:73609918..73609942 21/25 unknown
scaffold_6:80551243..80551267 21/25 unknown
scaffold_6:97508333..97508357 21/25 unknown
scaffold_6381:3389..3413 21/25 unknown
scaffold_6812:341..365 21/25 unknown
scaffold_6812:386..410 21/25 unknown
scaffold_6812:398..422 21/25 unknown
scaffold_6865:2317..2341 21/25 unknown
scaffold_6865:2832..2856 21/25 unknown
scaffold_6865:2835..2859 21/25 unknown
scaffold_7:111109298..111109322 21/25 unknown
scaffold_7:113651036..113651060 21/25 unknown
scaffold_7:115273629..115273653 21/25 unknown
scaffold_7:115273728..115273752 21/25 unknown
scaffold_7:115273737..115273761 21/25 unknown
scaffold_7:115273779..115273803 21/25 unknown
scaffold_7:115273791..115273815 21/25 unknown
scaffold_7:115273866..115273890 21/25 unknown
scaffold_7:115273977..115274001 21/25 unknown
scaffold_7:118002205..118002229 21/25 unknown
scaffold_7:119626675..119626699 21/25 unknown
scaffold_7:122627326..122627350 21/25 unknown
scaffold_7:122711666..122711690 21/25 unknown
scaffold_7:122711744..122711768 21/25 unknown
scaffold_7:122711827..122711851 21/25 unknown
scaffold_7:122711830..122711854 21/25 unknown
scaffold_7:16478264..16478288 21/25 unknown
scaffold_7:29765189..29765213 21/25 unknown
scaffold_7:35661689..35661713 21/25 unknown
scaffold_7:35661939..35661963 21/25 unknown
scaffold_7:35662025..35662049 21/25 unknown
scaffold_7:35662111..35662135 21/25 unknown
scaffold_7:35662114..35662138 21/25 unknown
scaffold_7:35662161..35662185 21/25 unknown
scaffold_7:35662201..35662225 21/25 unknown
scaffold_7:35662264..35662288 21/25 unknown
scaffold_7:51865898..51865922 21/25 unknown
scaffold_7:51865901..51865925 21/25 unknown
scaffold_7:60375174..60375198 21/25 unknown
scaffold_7:62718629..62718653 21/25 unknown
scaffold_7:6809136..6809160 21/25 unknown
scaffold_7149:3219..3243 21/25 unknown
scaffold_732:2102..2126 21/25 unknown
scaffold_732:2105..2129 21/25 unknown
scaffold_7646:1109..1133 21/25 unknown
scaffold_7646:963..987 21/25 unknown
scaffold_8:36691998..36692022 21/25 unknown
scaffold_8:50546952..50546976 21/25 unknown
scaffold_8:96140026..96140050 21/25 unknown
scaffold_8059:3665..3689 21/25 unknown
scaffold_811:1956..1980 21/25 unknown
scaffold_834:20414..20438 21/25 unknown
scaffold_834:20417..20441 21/25 unknown
scaffold_834:854..878 21/25 unknown
scaffold_86:340761..340785 21/25 unknown
scaffold_9:1352527..1352551 21/25 unknown
scaffold_9:1352708..1352732 21/25 unknown
scaffold_9:1352768..1352792 21/25 unknown
scaffold_9:1352840..1353021 21/25 Sense unknown
scaffold_9:22532186..22532210 21/25 unknown
scaffold_9:43943921..43943945 21/25 unknown
scaffold_9:73496572..73496596 21/25 unknown
scaffold_9:89150413..89150437 21/25 unknown
scaffold_9:93432822..93432846 21/25 unknown
scaffold_9:97286029..97286053 21/25 unknown
Publications
First: Identification of target genes for the Xenopus Hes-related protein XHR1, a prepattern factor specifying the midbrain-hindbrain boundary., Dev Biol 2005                      
Most recent:
View All Papers