Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249687

Morpholino Name: hes9.1 MO1
Synonyms: 8C9moA
Target mRNA: hes5.7

Morpholino Type: uncategorized morpholino
Sequence: 5' TTGGTAGCGCTGTAAGGAGCCATCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GGATGGCTCCTTACAGCGCTACCAA 3' ||||||||||||||||||||||||| 3' CCTACCGAGGAATGTCGCGATGGTT 5' 5' GGATGGCTCCTTACAACGCTAGCAG 3' ||||||||||||||| ||||| || 3' CCTACCGAGGAATGTCGCGATGGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7S:67848932..67848956 22/25 Antisense target hes5.7.S
chr7S:67832081..67832105 23/25 Antisense off-target hes5.5.S
chr7S:67838985..67839009 23/25 Antisense off-target hes5.6.S
chr6L:128368530..128368554 21/25 unknown
tropicalis 10.0 Chr7:99536024..99536048 25/25 Antisense target hes5.7
Chr7:99528198..99528222 25/25 Antisense off-target LOC116412194
Chr7:99520739..99520763 23/25 Antisense off-target hes5.5
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers