Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249688

Morpholino Name: hes9.1 MO2
Synonyms: esr9
Target mRNA: hes5.7

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTCTGGTAATGGGATGTGATGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCCATCACATCCCATTACCAGACAG 3' ||||||||||||||||||||||||| 3' AGGTAGTGTAGGGTAATGGTCTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:93706601..93706625 25/25 Antisense target hes5.7.L
chr7L:93695519..93695543 25/25 Antisense off-target hes5.6.L
chr7L:93689699..93689723 24/25 Antisense off-target hes5.5.L
chr8S:84124108..84124132 22/25 unknown
tropicalis 10.0 Chr4:2124873..2124897 22/25 Sense off-target LOC100485132
Chr7:99528174..99528198 22/25 Antisense off-target LOC116412194
Chr5:123632531..123632555 21/25 Antisense off-target spsb4
Chr8:81055733..81055757 22/25 unknown
Publications
First: The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen., Development 2006                    
Most recent:
View All Papers