Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249694

Morpholino Name: hgf MO1
Synonyms: HGF MO, HGF-MO
mRNA Target: hgf

Morpholino Type: uncategorized morpholino
Sequence:
5' TGAGAGATGTTGCCTGGTGGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/22
genomic

MO
5' AACCACCAGGCAACATCTCTCA 3' |||||||||||||||||||||| 3' TTGGTGGTCCGTTGTAGAGAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold33104:3756712..3756733 22/22 Antisense off-target Xelaev16043972m
Scaffold12518:15607411..15607432 21/22 Antisense off-target Xelaev16007453m
Scaffold13204:1973763..1973784 19/22 unknown
Scaffold255257:984272..984293 19/22 unknown
Scaffold74352:5428428..5428449 19/22 unknown
Scaffold8834:726394..726415 19/22 unknown
Scaffold103933:28321..28342 18/22 unknown
Scaffold167347:2881010..2881031 18/22 Sense off-target Xelaev16019101m
tropicalis 7.1 scaffold_3:107885652..107885673 22/22 Antisense target hgf
scaffold_2:37798785..37798806 20/22 unknown
scaffold_2:145587982..145588003 19/22 unknown
scaffold_8:100392506..100392527 19/22 unknown
scaffold_1:165891332..165891353 18/22 unknown
scaffold_1:173205269..173205290 18/22 unknown
scaffold_1:55236435..55236456 18/22 unknown
scaffold_10:6402342..6402363 18/22 Antisense off-target LOC100489773
scaffold_2:14065331..14065352 18/22 Sense off-target ppt1
scaffold_2:19083228..19083249 18/22 unknown
scaffold_3:101553840..101553861 18/22 unknown
scaffold_3:23375967..23375988 18/22 unknown
scaffold_3:27581078..27581099 18/22 Antisense off-target agbl1
scaffold_3:94823405..94823426 18/22 unknown
scaffold_341:41644..41665 18/22 unknown
scaffold_4:100780976..100780997 18/22 unknown
scaffold_4:64450123..64450144 18/22 Antisense off-target ptbp2
scaffold_4892:3881..3902 18/22 unknown
scaffold_5:12878886..12878907 18/22 unknown
scaffold_5:31350720..31350741 18/22 unknown
scaffold_5:92682614..92682635 18/22 unknown
scaffold_6:100990554..100990575 18/22 unknown
scaffold_6:72664995..72665016 18/22 unknown
scaffold_6:92365285..92365306 18/22 unknown
scaffold_8:41584779..41584800 18/22 unknown
scaffold_8:45820180..45820201 18/22 Sense off-target dock11
scaffold_8:52569582..52569603 18/22 Sense off-target sipa1l3
scaffold_8:5769992..5770013 18/22 Sense off-target nup214
scaffold_8:75296378..75296399 18/22 unknown
scaffold_9:41362787..41362808 18/22 unknown
Publications
First: Essential role of HGF (hepatocyte growth factor) in blood formation in Xenopus., Blood 2004  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556