Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249696

Morpholino Name: hhex MO1
Synonyms: XHex MO, hex
mRNA Target: hhex

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGTGCTGGTACTGCATGTCGATTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 22/25
genomic

MO
5' AGAATAGCCATGCAGTACCAGCACC 3' |||| | ||||||||||||||||| 3' CCTTAGCTGTACGTCATGGTCGTGG 5' 5' GGAATCGACATGCAGTACCAGCACC 3' ||||||||||||||||||||||||| 3' CCTTAGCTGTACGTCATGGTCGTGG 5' 5' GGAATCATCATGCAGTACCAGCAGC 3' |||||| ||||||||||||||| | 3' CCTTAGCTGTACGTCATGGTCGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:20398360..20398384 25/25 Antisense target hhex.L
chr7S:15905746..15905770 22/25 Antisense target hhex.S
chr5L:31058434..31058458 21/25 Sense off-target ehbp1.L
chr7L:97766962..97766986 21/25 Antisense off-target LOC108695878 [provisional:casr]
Scaffold37:2076862..2076886 21/25 Antisense off-target LOC108704510
tropicalis 10.0 Chr7:25602631..25602655 22/25 Antisense target hhex
Publications
First: Xhex-expressing endodermal tissues are essential for anterior patterning in Xenopus., Mech Dev 2002              
Most recent: Homeoprotein hhex-induced conversion of intestinal to ventral pancreatic precursors results in the formation of giant pancreata in Xenopus embryos., Proc Natl Acad Sci U S A 2012                                
View All Papers