Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249698

Morpholino Name: hif1a MO1
Synonyms: MOATGhif-1alpha, hif-1alpha MO2
mRNA Target: hif1a

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCCGAAGCTGTGTCAAGCGCCGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CTCGGCGCTTGACACAGCTCCGGAG 3' ||||||||||||||||||| ||||| 3' GAGCCGCGAACTGTGTCGAAGCCTC 5' 5' CTCGGCGCTTGACACAGCTTCGGAG 3' ||||||||||||||||||||||||| 3' GAGCCGCGAACTGTGTCGAAGCCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:78573518..78573542 25/25 Antisense target hif1a.L
chr8S:8146311..8146335 24/25 Antisense off-target hif-1a
tropicalis 10.0 Chr8:101987537..101987561 24/25 Antisense target hif1a
Publications
First: HIF-1alpha signaling upstream of NKX2.5 is required for cardiac development in Xenopus., J Biol Chem 2008                          
Most recent: The hypoxia factor Hif-1α controls neural crest chemotaxis and epithelial to mesenchymal transition., J Cell Biol 2013                    
View All Papers