Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249699

Morpholino Name: hif1a MO2
Synonyms: hif-1alpha 5'-UTR MO1
mRNA Target: hif1a

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTCACTACTACTGATCCCTCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' CATGGAGGGATCTGTAGTAGCGAGC 3' |||||||||||| ||||||| || | 3' GTACCTCCCTAGTCATCATCACTTG 5' 5' CATGGAGGGATCAGTAGTAGTGAAC 3' ||||||||||||||||||||||||| 3' GTACCTCCCTAGTCATCATCACTTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:78573471..78573495 25/25 Antisense target hif1a.L
chr8S:8146358..8146382 23/25 Antisense off-target hif-1a
chr6S:61628032..61628056 21/25 Sense off-target cdh18.S
tropicalis 10.0 Chr8:101987490..101987514 22/25 Antisense target hif1a
Chr2:45682930..45682954 21/25 Sense off-target scarf1
Publications
First: HIF-1alpha signaling upstream of NKX2.5 is required for cardiac development in Xenopus., J Biol Chem 2008                          
Most recent:
View All Papers