Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249703

Morpholino Name: hira MO1
Synonyms: HIRA
mRNA Target: hira

Morpholino Type: uncategorized morpholino
Sequence:
5' AGCTTCATTGTCCCTCTGTGCCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/24 23/24
genomic

MO
5' GGGGCACTGCGGGACAATGAAGCT 3' |||||| | |||||||||||||| 3' ACCCGTGTCTCCCTGTTACTTCGA 5' 5' GGGGCACAGAGGGACAATGAAGCT 3' ||||||||||||||||||||||| 3' ACCCGTGTCTCCCTGTTACTTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:127237964..127237987 23/24 Antisense target hira.S
chr4S:85407667..85407690 21/24 Antisense off-target kcnt2.S
chr2S:115367110..115367133 20/24 Sense off-target LOC108709788
chr1L:39635652..39635675 21/24 unknown
chr3L:94926488..94926511 20/24 unknown
tropicalis 10.0 Chr1:154189516..154189539 21/24 Antisense target hira
Chr4:12551189..12551212 22/24 Antisense off-target ano1
Chr4:148916192..148916215 21/24 Antisense off-target arhgef3.2
Chr7:16340144..16340167 21/24 Sense off-target slc16a9
Chr10:34281996..34282019 20/24 unknown
Publications
First: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus., Cell Rep 2012                                        
Most recent: Shaping Chromatin in the Nucleus: The Bricks and the Architects., Cold Spring Harb Symp Quant Biol 2017              
View All Papers