Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249704

Morpholino Name: hist1h3g MO1
Synonyms: H3
Target mRNA: h3c8

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGTCTGTTTAGTACGAGCCATAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ACAATGGCTCGTACTAAGCAGACCG 3' | |||||||||||||| ||||||| 3' CGATACCGAGCATGATTTGTCTGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:6171793..6171817 22/25 Antisense target h3c8.S
Scaffold324:12678..12702 25/25 Antisense off-target LOC108705672 [provisional:h3c7]
chr5L:23137753..23137777 25/25 Antisense off-target LOC108716540 [provisional:h3c7]
chr5L:23181019..23181043 25/25 Antisense off-target LOC108716541 [provisional:h3c7]
Scaffold29:2648032..2648056 22/25 Antisense off-target LOC108704265
Scaffold29:2648032..2648056 22/25 Antisense off-target LOC108704296 [provisional:h3c7]
chr5S:6773663..6773687 22/25 Antisense off-target Xelaev18028550m
chr5S:6786580..6786604 22/25 Antisense off-target Xelaev18028555m
chr6S:1901999..1902023 22/25 Antisense off-target LOC108695575 [provisional:h3c7]
Scaffold22:1736646..1736670 21/25 Antisense off-target LOC108703784 [provisional:h3c7]
Scaffold29:2911043..2911067 21/25 Antisense off-target LOC108704297 [provisional:h3c7]
chr4L:79524098..79524122 21/25 Sense off-target artn.L
Scaffold22:1205799..1205823 21/25 Sense off-target Xetrov90029514m.L
Scaffold22:1205799..1205823 21/25 Antisense off-target LOC108703833
chr5L:23122000..23122024 25/25 unknown
Scaffold11084:899..923 25/25 unknown
chr5L:23219218..23219242 23/25 unknown
Scaffold22:1323431..1323455 21/25 unknown
Scaffold28815:573..597 21/25 unknown
tropicalis 10.0 Chr3:135396652..135396676 23/25 Antisense off-target LOC116409810
Chr3:135488062..135488086 23/25 Sense off-target LOC101734776
Chr3:135488062..135488086 23/25 Antisense off-target LOC108646286
Chr3:135506146..135506170 23/25 Antisense off-target LOC100496129
Chr3:135612778..135612802 23/25 Antisense off-target LOC116409812
Chr3:135618392..135618416 23/25 Antisense off-target LOC116409811
Chr3:135653765..135653789 23/25 Antisense off-target LOC100495338
Chr3:135661765..135661789 23/25 Antisense off-target LOC100493041
Chr3:135763487..135763511 23/25 Antisense off-target LOC100495788
Chr3:135234033..135234057 23/25 Antisense off-target h3c14
Chr3:135383979..135384003 23/25 Sense off-target LOC100493093
Chr3:135383979..135384003 23/25 Antisense off-target LOC108646287
Chr6:4062804..4062828 21/25 Antisense off-target LOC100487179
Chr3:135252765..135252789 23/25 unknown
Publications
First: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus., Cell Rep 2012                                        
Most recent:
View All Papers