Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249708

Morpholino Name: hmgb3 MO1
Synonyms: Hmgb3 MO, Xhmgb3 MO
mRNA Target: hmgb3

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTCTTAGGGTCACGTTTAGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' GATGGCTAAAGGTGACCCTAAGAAG 3' |||||||||| |||||||||||||| 3' CTACCGATTTGCACTGGGATTCTTC 5' 5' GATGGCTAAAGGTGACCCTAAGAAG 3' |||||||||| |||||||||||||| 3' CTACCGATTTGCACTGGGATTCTTC 5' 5' GATGGCTAAACGTGACCCTAAGAAG 3' ||||||||||||||||||||||||| 3' CTACCGATTTGCACTGGGATTCTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:64301433..64301457 25/25 Antisense target hmgb3.S
chr8L:36729701..36729725 24/25 Antisense target hmgb3.L
tropicalis 10.0 Chr8:58157999..58158023 24/25 Antisense target hmgb3
Publications
First: Nucleosome regulator Xhmgb3 is required for cell proliferation of the eye and brain as a downstream target of Xenopus rax/Rx1., Dev Biol 2006            
Most recent: Sumoylation controls retinal progenitor proliferation by repressing cell cycle exit in Xenopus laevis., Dev Biol 2010                                                    
View All Papers