Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249719

Morpholino Name: hoxa1 MO1
Synonyms: Hoxa1, PG1 MO, hoxa1-mo1
mRNA Target: hoxa1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCATCCTCCTCGCATAGTCCATCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' AGATGGACTATGCGAGGAGGATGAG 3' ||||||||||||||||||||||||| 3' TCTACCTGATACGCTCCTCCTACTC 5' 5' AGATGGACTATGCGAGGAGGATGAG 3' ||||||||||||||||||||||||| 3' TCTACCTGATACGCTCCTCCTACTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold125468:78..102 25/25 unknown
Scaffold178713:2091172..2091196 25/25 Antisense target hoxa1.L
Scaffold99185:793209..793233 25/25 Antisense target hoxa1.S
Scaffold120240:5194339..5194363 21/25 unknown
Scaffold138921:1900377..1900401 21/25 Antisense off-target Xelaev16011900m
Scaffold9266:6897882..6897906 21/25 unknown
Publications
First: Knockdown of the complete Hox paralogous group 1 leads to dramatic hindbrain and neural crest defects., Development 2005                      
Most recent: Hox and Pbx factors control retinoic acid synthesis during hindbrain segmentation., Dev Cell 2011    
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556