Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249720

Morpholino Name: hoxa1 MO2
Synonyms: PG1 MO, hoxa1-mo2
Target mRNA: hoxa1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCGCATAGTCCATCTATCACTAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CCTAGTGATAGATGGACTATGCGAG 3' ||||||||||||||||||||||||| 3' GGATCACTATCTACCTGATACGCTC 5' 5' CCTAGTGATAGATGGACTATGCGAG 3' ||||||||||||||||||||||||| 3' GGATCACTATCTACCTGATACGCTC 5' 5' CCTAGTGATAGATGGACTATGCGAG 3' ||||||||||||||||||||||||| 3' GGATCACTATCTACCTGATACGCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:39574590..39574614 25/25 Antisense target hoxa1.L
chr6S:33684042..33684066 25/25 Antisense target hoxa1.S
tropicalis 10.0 Chr6:42137984..42138008 25/25 Antisense target hoxa1
Publications
First: Knockdown of the complete Hox paralogous group 1 leads to dramatic hindbrain and neural crest defects., Development 2005                      
Most recent: Hox and Pbx factors control retinoic acid synthesis during hindbrain segmentation., Dev Cell 2011    
View All Papers