Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249721

Morpholino Name: hoxa2 MO1
Synonyms:
Target mRNA: hoxa2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTCTCGCTCAAATTCGTAATTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGAATTACGAATTTGAGCGAGAGA 3' ||||||||||||||||||||||||| 3' TACTTAATGCTTAAACTCGCTCTCT 5' 5' ATGAATTACGAATTTGAGCGAGAGA 3' ||||||||||||||||||||||||| 3' TACTTAATGCTTAAACTCGCTCTCT 5' 5' ATGAATTACGAATTTGAGCGAGAGA 3' ||||||||||||||||||||||||| 3' TACTTAATGCTTAAACTCGCTCTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:39587723..39587747 25/25 Antisense target hoxa2.L
chr6L:39590852..39590876 25/25 Antisense target hoxa2.L
chr6S:33695772..33695796 25/25 Antisense target hoxa2.S
tropicalis 10.0 Chr6:42147738..42147762 25/25 Antisense target hoxa2
Publications
First: Hoxa2 knockdown in Xenopus results in hyoid to mandibular homeosis., Dev Dyn 2005            
Most recent:
View All Papers