Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249724

Morpholino Name: hoxb1 MO1
Synonyms: PG1 MO, hoxb1-mo2
Target mRNA: hoxb1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTGCCAGTGATGGAGGAGGGTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' TGACCCTCCTCCATCACTGGCAGAT 3' ||||||||||||||||||||||||| 3' ACTGGGAGGAGGTAGTGACCGTCTA 5' 5' TGACCCTCCTCCATCACTGGCAGAT 3' ||||||||||||||||||||||||| 3' ACTGGGAGGAGGTAGTGACCGTCTA 5' 5' TGACCCTCCTCCATCACTGGCAGAT 3' ||||||||||||||||||||||||| 3' ACTGGGAGGAGGTAGTGACCGTCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:3447796..3447820 25/25 Antisense target hoxb1.L
chr9_10S:3085619..3085643 25/25 Antisense target hoxb1.S
chr9_10S:3085619..3085643 25/25 Sense off-target LOC108702522
chr2L:56927023..56927047 23/25 Antisense off-target nkain1.L
Scaffold16707:87..111 22/25 unknown
tropicalis 10.0 Chr10:11999130..11999154 25/25 Antisense target hoxb1
Chr2:79181280..79181304 22/25 Antisense off-target nkain1
Chr6:15656489..15656513 21/25 Antisense off-target dpp6
Publications
First: Knockdown of the complete Hox paralogous group 1 leads to dramatic hindbrain and neural crest defects., Development 2005                      
Most recent: Interaction between X-Delta-2 and Hox genes regulates segmentation and patterning of the anteroposterior axis., Mech Dev 2006                            
View All Papers