Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249725

Morpholino Name: hoxb1 MO2
Synonyms: Hoxb1, Hoxb1-MO1, PG1 MO
Target mRNA: hoxb1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGAACTCATTCTGCTATTGTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' ATGGACAATACCAGAATGAGTTCCT 3' |||||||||| |||||||||||||| 3' TACCTGTTATCGTCTTACTCAAGGA 5' 5' ATGGACAATACCAGAATGAGTTCCT 3' |||||||||| |||||||||||||| 3' TACCTGTTATCGTCTTACTCAAGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:3447773..3447797 24/25 Antisense target hoxb1.L
chr9_10S:3085596..3085620 24/25 Antisense target hoxb1.S
chr9_10S:3085596..3085620 24/25 Sense off-target LOC108702522
chr8L:56169155..56169179 22/25 Sense off-target LOC108698613 [provisional:gpr4]
Scaffold22:6268731..6268755 21/25 Antisense off-target LOC108703975
chr3S:82354267..82354291 21/25 Sense off-target twf1.S
chr4L:38322939..38322963 21/25 Sense off-target mbtps1.L
chr7S:14708622..14708646 21/25 Sense off-target dock1.S
Scaffold22:6242308..6242332 21/25 unknown
chr9_10L:21145370..21145394 21/25 unknown
Publications
First: Knockdown of the complete Hox paralogous group 1 leads to dramatic hindbrain and neural crest defects., Development 2005                      
Most recent: Interaction between X-Delta-2 and Hox genes regulates segmentation and patterning of the anteroposterior axis., Mech Dev 2006                            
View All Papers