Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249726

Morpholino Name: hoxb4 MO1
Synonyms: XHoxb4, anti-Hoxb4
mRNA Target: hoxb4

Morpholino Type: uncategorized morpholino
Sequence:
5' TGATCAAAAACGAACTCATTCTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGAGAATGAGTTCGTTTTTGATCA 3' ||||||||||||||||||||||||| 3' TACTCTTACTCAAGCAAAAACTAGT 5' 5' ATGAGAATGAGTTCGTTTTTGATCA 3' ||||||||||||||||||||||||| 3' TACTCTTACTCAAGCAAAAACTAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:1585283..1585307 25/25 Antisense target hoxb4.S
Scaffold75417:4344617..4344641 25/25 Antisense off-target Xelaev16071950m
Scaffold100253:3270078..3270102 21/25 unknown
Scaffold178713:2051378..2051402 21/25 Antisense off-target Xelaev16021617m
Scaffold300794:526259..526283 21/25 Sense off-target Xelaev16040449m
Scaffold399514:53..77 21/25 unknown
Scaffold99185:754196..754220 21/25 Antisense off-target Xelaev16080917m
tropicalis 7.1 scaffold_10:28933710..28933734 25/25 Antisense target hoxb4
scaffold_4:54223936..54223960 21/25 unknown
scaffold_6:103502411..103502435 21/25 Antisense off-target hoxa4
Publications
First: Flamingo, a cadherin-type receptor involved in the Drosophila planar polarity pathway, can block signaling via the canonical wnt pathway in Xenopus laevis., Int J Dev Biol 2003                
Most recent: FLASH, a component of the FAS-CAPSASE8 apoptotic pathway, is directly regulated by Hoxb4 in the notochord., Dev Biol 2004                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556