Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249726

Morpholino Name: hoxb4 MO1
Synonyms: XHoxb4, anti-Hoxb4
Target mRNA: hoxb4

Morpholino Type: uncategorized morpholino
Sequence: 5' TGATCAAAAACGAACTCATTCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGAGAATGAGTTCGTTTTTGATCA 3' ||||||||||||||||||||||||| 3' TACTCTTACTCAAGCAAAAACTAGT 5' 5' ATGAGAATGAGTTCGTTTTTGATCA 3' ||||||||||||||||||||||||| 3' TACTCTTACTCAAGCAAAAACTAGT 5' 5' ATGAGAATGAGTTCGTTTTTGATCA 3' ||||||||||||||||||||||||| 3' TACTCTTACTCAAGCAAAAACTAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:3498953..3498977 25/25 Antisense target hoxb4.L
chr9_10S:3133004..3133028 25/25 Antisense target hoxb4.S
chr9_10S:3133004..3133028 25/25 Sense off-target LOC108702522
chr9_10L:3498953..3498977 25/25 Antisense off-target hoxb3.L
chr9_10S:3133004..3133028 25/25 Antisense off-target LOC108702521
chr6L:33433248..33433272 21/25 Sense off-target scin.L
chr6L:39617381..39617405 21/25 Antisense off-target hoxa3.L
chr6L:39617381..39617405 21/25 Antisense off-target LOC108718897 [provisional:hoxa4]
chr6S:33722458..33722482 21/25 Antisense off-target hoxa3.S
chr6S:33722458..33722482 21/25 Antisense off-target LOC108719683 [provisional:hoxa4]
Scaffold78166:53..77 21/25 unknown
chr3L:41308351..41308375 21/25 unknown
tropicalis 10.0 Chr10:12049598..12049622 25/25 Antisense target hoxb4
Chr10:12049598..12049622 25/25 Antisense off-target hoxb3
Chr4:27381448..27381472 21/25 Sense off-target LOC100485197
Chr6:42174199..42174223 21/25 Antisense off-target hoxa3
Chr6:42174199..42174223 21/25 Antisense off-target hoxa4
Publications
First: Flamingo, a cadherin-type receptor involved in the Drosophila planar polarity pathway, can block signaling via the canonical wnt pathway in Xenopus laevis., Int J Dev Biol 2003                
Most recent: FLASH, a component of the FAS-CAPSASE8 apoptotic pathway, is directly regulated by Hoxb4 in the notochord., Dev Biol 2004                
View All Papers