Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249727

Morpholino Name: hoxd1 MO1
Synonyms: Hoxd1, PG1 MO, hoxd1-mo1
mRNA Target: hoxd1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGGAACCTGCTGATCCCTCAATCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' AAGATTGAGGGATCATCAGGTTCCT 3' ||||||||||||||| ||||||||| 3' TTCTAACTCCCTAGTCGTCCAAGGA 5' 5' AAGATTGAGGGATCAGCAGGTTCCT 3' ||||||||||||||||||||||||| 3' TTCTAACTCCCTAGTCGTCCAAGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold4321:5050456..5050480 25/25 Antisense target hoxd1.S
Scaffold43242:3907690..3907714 25/25 Antisense off-target Xelaev16053390m
tropicalis 7.1 scaffold_9:20757911..20757935 24/25 Antisense target hoxd1
Publications
First: Knockdown of the complete Hox paralogous group 1 leads to dramatic hindbrain and neural crest defects., Development 2005                      
Most recent: Interaction between X-Delta-2 and Hox genes regulates segmentation and patterning of the anteroposterior axis., Mech Dev 2006                            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556