Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249728

Morpholino Name: hoxd1 MO2
Synonyms: PG1 MO, hoxd1-mo2
mRNA Target: hoxd1

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGGTAGGAATTCATCTCTAGGGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CTCCCTAGAGATGAATTCCTACCTA 3' ||||||||||||||||||||||||| 3' GAGGGATCTCTACTTAAGGATGGAT 5' 5' CTCCCTAGAGATGAATTCCTACCTA 3' ||||||||||||||||||||||||| 3' GAGGGATCTCTACTTAAGGATGGAT 5' 5' CTCCCTAGAGATGAATTCCTACCTA 3' ||||||||||||||||||||||||| 3' GAGGGATCTCTACTTAAGGATGGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:67952667..67952691 25/25 Antisense target hoxd1.L
chr9_10S:62164012..62164036 25/25 Antisense target hoxd1.S
chr6S:6660100..6660124 21/25 unknown
chr9_10L:60029670..60029694 21/25 unknown
tropicalis 10.0 Chr9:65133938..65133962 25/25 Antisense target hoxd1
Publications
First: Knockdown of the complete Hox paralogous group 1 leads to dramatic hindbrain and neural crest defects., Development 2005                      
Most recent: Interaction between X-Delta-2 and Hox genes regulates segmentation and patterning of the anteroposterior axis., Mech Dev 2006                            
View All Papers