Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249732

Morpholino Name: htr3a MO1
Synonyms: xHtr3 MO1
mRNA Target: htr3a

Morpholino Type:
Sequence:
5' GATGTTAAGTGTAGAGTCATTCTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39730:881798-881822 25/25 unknown
Scaffold62355:687994-688018 25/25 unknown
Scaffold47533:349121-349145 21/25 unknown
Publications
First: Serotonin signaling is required for Wnt-dependent GRP specification and leftward flow in Xenopus. [Curr Biol 2012]
Most recent: A novel serotonin-secreting cell type regulates ciliary motility in the mucociliary epidermis of Xenopus tadpoles. [Development 2014]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556