Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249733

Morpholino Name: htr3a MO2
Synonyms: xHtr3 MO2
mRNA Target: htr3a

Morpholino Type:
Sequence:
5' ACAGATCAGAGTGTTTGCTTTGTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGACAAAGCAAACACTCTGATCTGT 3' ||||||||||||||||||||||||| 3' ACTGTTTCGTTTGTGAGACTAGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39730:961458..961482 25/25 Antisense target htr3a.L
Scaffold118142:1509377..1509401 22/25 unknown
Scaffold35184:1676507..1676531 22/25 unknown
Scaffold181903:3158853..3158877 21/25 unknown
tropicalis 7.1 scaffold_2:46023236..46023260 21/25 Sense off-target sytl5
Publications
First: Serotonin signaling is required for Wnt-dependent GRP specification and leftward flow in Xenopus. [Curr Biol 2012]
Most recent: A novel serotonin-secreting cell type regulates ciliary motility in the mucociliary epidermis of Xenopus tadpoles. [Development 2014]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556