Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249734

Morpholino Name: htra1 MO1
Synonyms: xHtrA1-MO
mRNA Target: htra1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACACCGCCAGCCACAACATGGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 24/25
genomic

MO
5' ATGGCCATGTTGTGGCTGGCAGTGC 3' ||| |||||||||||||||| ||| 3' TACTGGTACAACACCGACCGCCACA 5' 5' ATGACCATGTTGTGGCTGGCGGTGC 3' |||||||||||||||||||||||| 3' TACTGGTACAACACCGACCGCCACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold109997:526266..526290 25/25 Antisense off-target Xelaev16002584m
Scaffold16863:9219662..9219686 24/25 Antisense target htra1.S
Scaffold27067:1538638..1538662 22/25 Sense off-target Xelaev16036830m
tropicalis 7.1 scaffold_7:15206079..15206103 22/25 Antisense target htra1
scaffold_7:60404983..60405007 22/25 unknown
scaffold_5:116986537..116986561 21/25 unknown
Publications
First: The secreted serine protease xHtrA1 stimulates long-range FGF signaling in the early Xenopus embryo., Dev Cell 2007                        
Most recent: The serpin PN1 is a feedback regulator of FGF signaling in germ layer and primary axis formation., Development 2015                                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556