Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249740

Morpholino Name: id3 MO1
Synonyms: Id3 MO, Id3-MO
mRNA Target: id3

Morpholino Type:
Sequence:
5' GGGTGTCAGAGATGATTGCTGGAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' GCTCCAGCAATCATCTCTGACACCC 3' ||||||||||||||||||||||||| 3' CGAGGTCGTTAGTAGAGACTGTGGG 5' 5' GCTCCAGCAATCTTCTCCGACATCA 3' |||||||||||| |||| |||| | 3' CGAGGTCGTTAGTAGAGACTGTGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8834:232426-232450 25/25 Antisense target id3.L
Scaffold98463:1551917-1551941 21/25 Antisense target id3.S
tropicalis 7.1 scaffold_4:26562150-26562174 21/25 Antisense off-target rpgrip1l
scaffold_4:98499047-98499071 21/25 Antisense off-target szt2
scaffold_4:98530255-98530279 21/25 Antisense off-target szt2
scaffold_6071:1897-1921 21/25 unknown
scaffold_7:47497249-47497273 21/25 Sense off-target tspan14
Publications
First: To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors. [Genes Dev 2005]
Most recent: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification. [EMBO J 2010]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556