Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249741

Morpholino Name: id3 MO2
Synonyms: ID3, Id3 MO
mRNA Target: id3

Morpholino Type:
Sequence:
5' ACCGCACTGGGCTGATGGCTTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' ATGAAAGCCATCAGCCCAGTGAGGT 3' ||||||||||||||||||||| ||| 3' TACTTTCGGTAGTCGGGTCACGCCA 5' 5' ATGAAAGCCATCAGCCCAGTGCGGT 3' ||||||||||||||||||||||||| 3' TACTTTCGGTAGTCGGGTCACGCCA 5' 5' ATGAAAGCCATCAGCCCAGTGAGGT 3' ||||||||||||||||||||| ||| 3' TACTTTCGGTAGTCGGGTCACGCCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8834:232456-232480 25/25 Antisense target id3.L
Scaffold98463:1551947-1551971 24/25 Antisense target id3.S
tropicalis 7.1 scaffold_2:1349123-1349147 24/25 Antisense target id3
Publications
First: Xenopus Id3 is required downstream of Myc for the formation of multipotent neural crest progenitor cells. [Development 2005]
Most recent: Hairy2-Id3 interactions play an essential role in Xenopus neural crest progenitor specification. [Dev Biol 2008]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556