Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249743

Morpholino Name: id3 MO4
Synonyms: 16G8moA
mRNA Target: id3

Morpholino Type:
Sequence:
5' TGGCTTTCATGGTGGCGTCAGAGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATCTCTGACGCCACCATGAAAGCCA 3' ||||||||||||||||||||||||| 3' TAGAGACTGCGGTGGTACTTTCGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold85591:2933949-2933973 22/25 unknown
tropicalis 7.1 scaffold_2:1349138-1349162 25/25 Antisense target id3
scaffold_112:288370-288394 21/25 unknown
scaffold_5:80095212-80095236 21/25 Sense off-target acat2
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development. [Dev Dyn 2004]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556