Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249745

Morpholino Name: ier2 MO1
Synonyms: XIer2a MO
mRNA Target: ier2

Morpholino Type:
Sequence:
5' CCATCTCACTTTCCAATGCTGAACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGTTCAGCATTGGAAAGTGAGATGG 3' ||||||||||||||||||||||||| 3' CCAAGTCGTAACCTTTCACTCTACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold55171:1082649-1082673 25/25 Antisense target ier2.L
Scaffold12879:3880419-3880443 22/25 unknown
Scaffold63696:1013076-1013100 21/25 unknown
tropicalis 7.1 scaffold_5:55647909-55647933 21/25 unknown
Publications
First: XIer2 is required for convergent extension movements during Xenopus development. [Int J Dev Biol 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556