Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249746

Morpholino Name: ier2 MO2
Synonyms: XIer2b MO
mRNA Target: ier2

Morpholino Type: uncategorized morpholino
Sequence:
5' GCATCTTGTGCTGCTTCTTCCGCGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_1:34811623..34811647 21/25 unknown
scaffold_9:1461687..1461711 21/25 Antisense off-target ercc3
Publications
First: XIer2 is required for convergent extension movements during Xenopus development., Int J Dev Biol 2011                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556