Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249747

Morpholino Name: ift52 MO1
Synonyms: IFT52
mRNA Target: ift52

Morpholino Type: uncategorized morpholino
Sequence:
5' AAGCAATCTGTTTGTTGACTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold146311:336081..336105 21/25 Antisense off-target Xelaev16013558m
Scaffold373399:2996582..2996606 21/25 Sense off-target Xelaev16048597m
Scaffold88819:1290180..1290204 21/25 Sense off-target Xelaev16077519m
tropicalis 7.1 scaffold_5:121226025..121226049 21/25 unknown
Publications
First: The hydrolethalus syndrome protein HYLS-1 links core centriole structure to cilia formation., Genes Dev 2009                  
Most recent: Integration of over 9,000 mass spectrometry experiments builds a global map of human protein complexes., Mol Syst Biol 2017                          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556