Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249748

Morpholino Name: ift88 MO1
Synonyms: xPol MO, xPol-MO
mRNA Target: ift88

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCACGAGATGGACATTTTGCATCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' TGATGCAAAATGTTCATCTGGTGCC 3' ||||||||||||| ||||| ||||| 3' ACTACGTTTTACAGGTAGAGCACGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold334424:763595..763619 25/25 Antisense off-target Xelaev16044214m
Scaffold51452:4489479..4489503 21/25 unknown
Scaffold68717:270353..270377 21/25 unknown
tropicalis 7.1 scaffold_2:109142883..109142907 23/25 Antisense target ift88
Publications
First: Xenopus Bicaudal-C is required for the differentiation of the amphibian pronephros., Dev Biol 2007                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556