Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249749

Morpholino Name: ift88 MO2
Synonyms: Polaris, polaris MO
mRNA Target: ift88

Morpholino Type: uncategorized morpholino
Sequence:
5' GCACGAGATGGACATTTTGCATCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATGATGCAAAATGTTCATCTGGTGC 3' |||||||||||||| ||||| |||| 3' TACTACGTTTTACAGGTAGAGCACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold334424:763596..763620 25/25 Antisense off-target Xelaev16044214m
Scaffold68717:270352..270376 22/25 unknown
tropicalis 7.1 scaffold_2:109142884..109142908 23/25 Antisense target ift88
Publications
First: The hydrolethalus syndrome protein HYLS-1 links core centriole structure to cilia formation., Genes Dev 2009                  
Most recent: Stabilization of speckle-type POZ protein (Spop) by Daz interacting protein 1 (Dzip1) is essential for Gli turnover and the proper output of Hedgehog signaling., J Biol Chem 2013                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556