Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249750

Morpholino Name: ift88 MO3
Synonyms: ift88
mRNA Target: ift88

Morpholino Type: uncategorized morpholino
Sequence:
5' GCACCAGATGAACATTTTGCATCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGATGCAAAATGTTCATCTGGTGC 3' ||||||||||||||||||||||||| 3' TACTACGTTTTACAAGTAGACCACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold334424:763596..763620 23/25 Antisense off-target Xelaev16044214m
Scaffold35361:148722..148746 22/25 Antisense off-target Xelaev16046320m
Scaffold36364:6237553..6237577 22/25 unknown
Scaffold154389:1391122..1391146 21/25 Sense off-target ncam1.S
Scaffold163806:2516258..2516282 21/25 Sense off-target Xelaev16018253m
Scaffold24235:3030505..3030529 21/25 unknown
Scaffold47091:54518..54542 21/25 Antisense off-target Xelaev16056459m
Scaffold63138:109864..109888 21/25 unknown
tropicalis 7.1 scaffold_2:109142884..109142908 25/25 Antisense target ift88
scaffold_4:98995057..98995081 22/25 unknown
scaffold_2:113702759..113702783 21/25 unknown
scaffold_5:83561557..83561581 21/25 Sense off-target ttc27
scaffold_64:296868..296892 21/25 unknown
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556