Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249751

Morpholino Name: igf1r MO1
Synonyms: IGFR mo, MoIGF-1R
mRNA Target: igf1r

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCTTCATGTCCACAAACAAGTCCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23872:837371..837395 25/25 Antisense off-target Xelaev16031711m
Scaffold58049:2210785..2210809 25/25 Antisense off-target Xelaev16063690m
Scaffold43061:2590520..2590544 21/25 unknown
Scaffold7197:22964..22988 21/25 Antisense off-target ppcdc.S
Scaffold91427:27..51 21/25 unknown
tropicalis 7.1 scaffold_3:31131009..31131033 25/25 unknown
Publications
First: The IGF pathway regulates head formation by inhibiting Wnt signaling in Xenopus., Dev Biol 2002                      
Most recent: Integration of IGF, FGF, and anti-BMP signals via Smad1 phosphorylation in neural induction., Genes Dev 2003  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556