Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249752

Morpholino Name: igf2bp3 MO1
Synonyms: Vg1 RBP, xVICKZ3
mRNA Target: igf2bp3

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAGAAGACGAGCCCGAAAAACCCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' CAGGCTTTTTGGGCTCGTCTTCTTT 3' | || |||| ||||||||||||||| 3' GCCCAAAAAGCCCGAGCAGAAGAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold222217:1147880..1147904 24/25 Antisense off-target Xelaev16029093m
Scaffold3586:1124632..1124656 21/25 Sense off-target fcho1.L
Scaffold4280:82..106 21/25 unknown
tropicalis 7.1 scaffold_6:105306155..105306179 22/25 Antisense target igf2bp3
Publications
First: The RNA-binding protein Vg1 RBP is required for cell migration during early neural development., Development 2003                
Most recent: A Novel Role for VICKZ Proteins in Maintaining Epithelial Integrity during Embryogenesis., PLoS One 2015              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556