Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249753

Morpholino Name: igf2bp3 MO2
Synonyms: Vg1RBP AMO
mRNA Target: igf2bp3

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAGAAGACGAGCCCAAAAACCCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24
genomic

MO
5' AGGCTTTTTGGGCTCGTCTTCTTT 3' || |||||||||||||||||||| 3' GCCCAAAAACCCGAGCAGAAGAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold222217:1147880..1147903 21/24 Antisense off-target Xelaev16029093m
Scaffold11199:1904551..1904574 20/24 unknown
tropicalis 7.1 scaffold_6:105306156..105306179 22/24 Antisense target igf2bp3
scaffold_4:25646062..25646085 20/24 unknown
scaffold_8:287271..287294 20/24 unknown
Publications
First: RNA-binding protein Vg1RBP regulates terminal arbor formation but not long-range axon navigation in the developing visual system., Dev Neurobiol 2014  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556