Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249777

Morpholino Name: irs1 MO2
Synonyms: iirs-1 MO
mRNA Target: irs1

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCCCACATCTCCTAATATTCATAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TTATGAATATAAGGAGATGTGGGCA 3' |||||||||| |||||||||||||| 3' AATACTTATAATCCTCTACACCCGT 5' 5' TTATGAATATTAGGAGATGTGGGCA 3' ||||||||||||||||||||||||| 3' AATACTTATAATCCTCTACACCCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold172068:2623933..2623957 25/25 Antisense target irs1.L
Scaffold82102:4324589..4324613 25/25 Antisense off-target Xelaev16075167m
tropicalis 7.1 scaffold_5:22428759..22428783 24/25 Antisense target irs1
scaffold_5:105232477..105232501 22/25 unknown
scaffold_9:59889592..59889616 22/25 unknown
scaffold_1:131100073..131100097 21/25 unknown
scaffold_6:95004935..95004959 21/25 unknown
Publications
First: Xenopus laevis insulin receptor substrate IRS-1 is important for eye development., Dev Dyn 2011              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556