Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249791

Morpholino Name: jarid2 MO3
Synonyms: Jarid2 MO2b
mRNA Target: jarid2

Morpholino Type:
Sequence:
5' GGCCTTTCCTTGCTCATCCTGTTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGAACAGGATGAGCAAGGAAAGGCC 3' ||||||||||||||||||||||||| 3' TCTTGTCCTACTCGTTCCTTTCCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold11136:1087723-1087747 25/25 Antisense target jarid2.L
Scaffold90265:506187-506211 24/25 Antisense off-target Xelaev16078158m
Scaffold21588:461808-461832 21/25 Sense off-target Xelaev16027607m
tropicalis 7.1 scaffold_6:57929787-57929811 22/25 unknown
Publications
First: Jarid2/Jumonji coordinates control of PRC2 enzymatic activity and target gene occupancy in pluripotent cells. [Cell 2009]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556