Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249792

Morpholino Name: jun MO1
Synonyms: MO-jun55
mRNA Target: jun

Morpholino Type:
Sequence:
5' GTAGTTTCCATCTTTGCGTTCATAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTATGAACGCAAAGATGGAAACTAC 3' ||||||||||||||||||||||||| 3' CATACTTGCGTTTCTACCTTTGATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold155039:3688156-3688180 25/25 Antisense target jun.L
Scaffold53042:2572618-2572642 22/25 Antisense off-target Xelaev16060945m
Publications
First: Transcriptional regulation of Zic3 by heterodimeric AP-1(c-Jun/c-Fos) during Xenopus development. [Exp Mol Med 2004]
Most recent: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation. [J Cell Biol 2015]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556