Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249793

Morpholino Name: jun MO2
Synonyms: MO-jun54
mRNA Target: jun

Morpholino Type:
Sequence:
5' CTGGAGCTTATGTCAGTGTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold53042:2572572-2572592 21/21 Antisense off-target Xelaev16060945m
Scaffold179290:2698550-2698570 19/21 unknown
Scaffold25194:5838851-5838871 19/21 unknown
Scaffold357348:496105-496125 18/21 Sense off-target Xelaev16046813m
Scaffold5925:6657018-6657038 18/21 unknown
Scaffold59883:2245490-2245510 18/21 Sense off-target Xelaev16065321m
Scaffold71264:2312986-2313006 18/21 Antisense off-target Xelaev16069955m
Scaffold52441:9198301-9198321 17/21 Antisense off-target Xelaev16060208m
Scaffold91950:1976414-1976434 17/21 Sense off-target Xelaev16078523m
tropicalis 7.1 scaffold_2:140815036-140815056 19/21 unknown
scaffold_1:208052097-208052117 18/21 unknown
scaffold_2:46867452-46867472 18/21 unknown
scaffold_9:76368277-76368297 18/21 unknown
Publications
First: Transcriptional regulation of Zic3 by heterodimeric AP-1(c-Jun/c-Fos) during Xenopus development. [Exp Mol Med 2004]
Most recent: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation. [J Cell Biol 2015]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556