Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249795

Morpholino Name: jund MO2
Synonyms:
mRNA Target: jund

Morpholino Type:
Sequence:
5' TGATAGAAGGGTATTTCCATCATCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GGATGATGGAAATACCCTTCTATCA 3' ||||||||||||||||||||||||| 3' CCTACTACCTTTATGGGAAGATAGT 5' 5' GGATGATGGAAATACCCTTCTATCA 3' ||||||||||||||||||||||||| 3' CCTACTACCTTTATGGGAAGATAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold231526:163176-163200 25/25 Antisense target jund.S
Scaffold72621:1314714-1314738 25/25 Antisense off-target Xelaev16070273m
Scaffold30987:5502284-5502308 22/25 unknown
tropicalis 7.1 scaffold_1:123111708-123111732 25/25 Antisense target jund
scaffold_1:162781258-162781282 21/25 unknown
Publications
First: The role of heterodimeric AP-1 protein comprised of JunD and c-Fos proteins in hematopoiesis. [J Biol Chem 2012]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556