Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249796

Morpholino Name: jup MO1
Synonyms: plakoglobin MO, plakoglobin-MO
mRNA Target: jup

Morpholino Type:
Sequence:
5' TTTCCACTACGTCTCCCAAATCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ATGGATATGGTAGACGTAGTGGATA 3' |||||| ||| |||||||||||| | 3' TACCTAAACCCTCTGCATCACCTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:3933610-3933634 25/25 Sense off-target Xelaev16009402m
Scaffold75417:6951061-6951085 22/25 Antisense target jup.L
Scaffold47533:3817788-3817812 21/25 unknown
Scaffold7045:2856898-2856922 21/25 unknown
Scaffold99286:3166381-3166405 21/25 unknown
Publications
First: A mechanoresponsive cadherin-keratin complex directs polarized protrusive behavior and collective cell migration. [Dev Cell 2012]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556