Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249797

Morpholino Name: kazn MO1
Synonyms: KMO1, xKazrin
mRNA Target: kazn

Morpholino Type:
Sequence:
5' GCTTGTTATCTTCCATCATCTTCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold109184:1202834..1202858 25/25 Antisense off-target Xelaev16002244m
Scaffold145587:57..81 25/25 unknown
Scaffold208071:87950..87974 25/25 Antisense off-target Xelaev16026908m
Scaffold33104:2180199..2180223 22/25 unknown
Scaffold58517:505874..505898 21/25 unknown
tropicalis 7.1 scaffold_7:90225676..90225700 25/25 unknown
scaffold_2:125559593..125559617 21/25 unknown
scaffold_3:7104629..7104653 21/25 unknown
scaffold_722:20548..20572 21/25 Antisense off-target hsp90ab1
Publications
First: Xenopus Kazrin interacts with ARVCF-catenin, spectrin and p190B RhoGAP, and modulates RhoA activity and epithelial integrity. [J Cell Sci 2010]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556