Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249798

Morpholino Name: kazn MO2
Synonyms: KMO1
mRNA Target: kazn

Morpholino Type:
Sequence:
5' CTGCTTGTTATCTTCCATCATCTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold109184:1202832-1202856 25/25 Antisense off-target Xelaev16002244m
Scaffold145587:59-83 25/25 unknown
Scaffold208071:87948-87972 25/25 Antisense off-target Xelaev16026908m
Scaffold13576:4680281-4680305 21/25 Sense off-target Xelaev16010849m
Scaffold7546:1883107-1883131 21/25 Sense off-target Xelaev16072280m
tropicalis 7.1 scaffold_7:90225674-90225698 25/25 unknown
scaffold_722:20550-20574 21/25 Antisense off-target hsp90ab1
Publications
First: KazrinA is required for axial elongation and epidermal integrity in Xenopus tropicalis. [Dev Dyn 2008]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556