Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249799

Morpholino Name: kazn MO3
Synonyms: KMO2
mRNA Target: kazn

Morpholino Type:
Sequence:
5' GCAGCATGGTGGGTAAGTGCAACTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold109184:1202890..1202914 23/25 Antisense off-target Xelaev16002244m
Scaffold145587:1..25 23/25 unknown
Scaffold208071:88006..88030 23/25 Antisense off-target Xelaev16026908m
Scaffold102974:8556118..8556142 21/25 unknown
Scaffold195950:1625070..1625094 21/25 unknown
Scaffold265107:5409095..5409119 21/25 unknown
Scaffold299965:1484613..1484637 21/25 Antisense off-target Xelaev16040314m
Scaffold82102:4721669..4721693 21/25 unknown
tropicalis 7.1 scaffold_7:90225732..90225756 25/25 unknown
scaffold_7:29547201..29547225 21/25 Antisense off-target hpse2
scaffold_9:7268012..7268036 21/25 unknown
Publications
First: KazrinA is required for axial elongation and epidermal integrity in Xenopus tropicalis. [Dev Dyn 2008]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556