Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249800

Morpholino Name: kazn MO4
Synonyms: Kazrin Mo-S
mRNA Target: kazn

Morpholino Type:
Sequence:
5' AAACCATTTTTGCCCTCACCTTTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' AGAAAGGTGAGGGTAAAAATTGTTT 3' ||||||||||||| |||||| |||| 3' TCTTTCCACTCCCGTTTTTACCAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold109184:1136034-1136058 25/25 Antisense off-target Xelaev16002244m
Scaffold208071:7229-7253 24/25 unknown
Scaffold24597:14237-14261 22/25 unknown
Scaffold110140:39006-39030 21/25 Sense off-target Xelaev16002627m
Scaffold14557:8042957-8042981 21/25 Sense off-target crhr1.2.S
Scaffold230826:1154048-1154072 21/25 unknown
Scaffold7328:794181-794205 21/25 unknown
Scaffold79166:819477-819501 21/25 unknown
tropicalis 7.1 scaffold_10:27441356-27441380 23/25 Antisense target kazn
scaffold_9:19057658-19057682 22/25 Antisense off-target cdca7
Publications
First: Kazrin, and its binding partners ARVCF- and delta-catenin, are required for Xenopus laevis craniofacial development. [Dev Dyn 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556