Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249801

Morpholino Name: kcnab2 MO1
Synonyms: Kvbeta2MO
mRNA Target: kcnab2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGTCTGTGGTCGATTCTGGATACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold87017:3232945..3232969 25/25 unknown
Scaffold208071:2998145..2998169 24/25 unknown
tropicalis 7.1 scaffold_7:93375520..93375544 25/25 unknown
Publications
First: Kv1 potassium channel complexes in vivo require Kvbeta2 subunits in dorsal spinal neurons., J Neurophysiol 2008  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556