Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249802

Morpholino Name: kctd10 MO1
Synonyms: xBACURDbeta
mRNA Target: kctd10

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTGACATCTCTTCCATCAAACCGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CCGGTTTGATGGAAGAGATGTCAGG 3' ||||||||||||||||||||||||| 3' GGCCAAACTACCTTCTCTACAGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold220553:64806..64830 22/25 unknown
Scaffold267922:530137..530161 21/25 unknown
tropicalis 7.1 scaffold_1:61139384..61142560 25/25 Antisense target kctd10
Publications
First: Cullin mediates degradation of RhoA through evolutionarily conserved BTB adaptors to control actin cytoskeleton structure and cell movement., Mol Cell 2009                                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556