Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249803

Morpholino Name: kiaa1324l MO1
Synonyms: xEIG121L Moalpha
mRNA Target: elapor2

Morpholino Type: uncategorized morpholino
Sequence:
5' ATCCACTCCAGCAGAAAACCCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATGGGGTTTTCCTGCTGGAGTGGAT 3' |||||| ||| |||||||||||||| 3' TACCCCCAAAAGACGACCTCACCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12518:13813522..13813546 25/25 Antisense off-target Xelaev16007431m
Scaffold33104:5433466..5433490 23/25 Antisense off-target Xelaev16043997m
Scaffold202158:3065300..3065324 21/25 Antisense off-target Xelaev16025773m
tropicalis 7.1 scaffold_3:109601021..109601045 23/25 Antisense target kiaa1324l
scaffold_5:108249330..108249354 21/25 unknown
Publications
First: A transmembrane protein EIG121L is required for epidermal differentiation during early embryonic development., J Biol Chem 2011  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556